Eng | Ru

ГенТест SLCO1B1

Набор реагентов для выявления полиморфизма в гене человека SLCO1B1 методом ПЦР-РВ

Ген SLCO1B1 кодирует транспортный белок SLCO1B1 (синонимы - OATP1B1, OATP-C), который стимулирует интернализацию статинов клетками печени. Наиболее значимым полиморфным вариантом гена является rs4149056, характеризующийся транзицией T на C в кодирующей области c.521T>C. Носительство аллеля C ассоциировано со снижением транспортной активности белка SLCO1B1, увеличением времени циркуляции статинов в крови и возрастанием риска токсических эффектов - миопатии, рабдомиолиза и почечной недостаточности.

Определяемые полиморфизмы

ГЕНПОЛИМОРФИЗМНОМЕНКЛАТУРА HGVSИДЕНТИФИКАТОР dbSNPФЛАНКИРУЮЩАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ
SLCO1B1 SLCO1B1c.521 T>C NG_011745.1:g.52422T>C
NM_006446.4:c.521T>C
NP_006437.3:p.Val174Ala
rs4149056 GTCATACATGTGGATATATG[T/C]
GTTCATGGGTAATATGCTTC

Основные характеристики

  • Анализ обоих аллелей в одной пробирке
  • Два канала детекции - FAM и HEX
  • Автоматический анализ результатов с помощью ПО ГенТест
  • Анализ от 10 до 44 образцов
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей
  • Предел обнаружения - от 0.2 нг/мкл ДНК

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Инструкция к набору
Скачать (pdf)
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Графики амплификации образцов:

А, Б - гомозиготные;
В - гетерозиготный.

ПРОДУКТКАТ.№КОЛ-ВОЦЕНА, РУБ.
ГенТест SLCO1B1 R2003 100 реакций (от 10 до 44 образцов)

Задать вопрос или заказать: order@evrogen.ru

© 2002-2020 Евроген.
Россия, Москва, ул. Миклухо-Маклая 16/10.