Eng | Ru

ГенТест-М NAT2

Набор реагентов для выявления полиморфизмов в гене человека NAT2 методом ПЦР-РВ

Ген NAT2 кодирует N-ацетил-трансферазу 2. Нуклеотидные замены C282T, T341C, C481T, G590A, A803G и G857A в этом гене приводят к изменению скорости ацетилирования изониазида, сульфаниламида, гидралазина, новокаинамида, амринона, кофеина, аминоглютетимида, дапсона, натрия аминосалицилата, нитразепама, бензидина, аминофлюорена, 4-аминобифенила, β-нафтиламина, 2-аминофлюорена, 2-аминоантрацена, серотонина, гистамина, дофамина и других веществ. Носительство различных сочетаний аллелей приводит к нарушениям метаболизма субстратов NAT2, и в том числе это может приводить к индивидуальной непереносимости фармакологических препаратов, соединений, поступающих с пищей, аномалиям работы нервной и иммунной систем и другим негативным последствиям, влияющим на качество жизни.

Определяемые полиморфизмы

ГЕНПОЛИМОРФИЗМНОМЕНКЛАТУРА HGVSИДЕНТИФИКАТОР dbSNPФЛАНКИРУЮЩАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ
NAT2 C282T NG_012246.1:g.14041C>T
NM_000015.2:c.282C>T NP_000006.2:p.Tyr94=
rs1041983 ATGTTAGGAGGGTATTTTTA[C/T]
ATCCCTCCAGTTAACAAATA
T341C NG_012246.1:g.14100T>C
NM_000015.2:c.341T>C
NP_000006.2:p.Ile114Thr
rs1801280 CCTTCTCCTGCAGGTGACCA[T/C]
TGACGGCAGGAATTACATTG
C481T NG_012246.1:g.14240C>T
NM_000015.2:c.481C>T
NP_000006.2:p.Leu161=
rs1799929 AAGAGAGAGGAATCTGGTAC[C/T]
TGGACCAAATCAGGAGAGAG
G590A NG_012246.1:g.14349G>A
NM_000015.2:c.590G>A
NP_000006.2:p.Arg197Gln
rs1799930 CTTATTTACGCTTGAACCTC[G/A]
AACAATTGAAGATTTTGAGT
A803G NG_012246.1:g.14562G>A
NM_000015.2:c.803G>A
NP_000006.2:p.Arg268Lys
rs1208 AGAGGTTGAAGAAGTGCTGA[A/G]
AAATATATTTAAGATTTCCT
G857A NG_012246.1:g.14616G>A
NM_000015.2:c.857G>A
NP_000006.2:p.Gly286Glu
rs1799931 CGTGCCCAAACCTGGTGATG[G/A]
ATCCCTTACTATTTAGAATA

Основные характеристики

  • Анализ обоих аллелей одного полиморфизма в одной пробирке
  • Определение генотипа по температуре плавления дуплекса зонд+ДНК
  • Требуется один канал детекции - FAM
  • Анализ от 10 до 44 образцов
  • Для исследования ДНК, выделенной из крови, буккального эпителия, тканей
  • Предел обнаружения - от 1 нг/мкл ДНК
  • Автоматизированный расчет влияния генотипа по полиморфным сайтам NAT2 на скорость реакций ацетилирования с помощью онлайн инструмента NAT2PRED

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad);
StepOnePlus Real-Time PCR System (Applied Biosystems);
7500 Real-Time PCR Systems (Applied Biosystems).

Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Графики амплификации образцов:

А, Б - гомозиготные;
В - гетерозиготный.

ПРОДУКТКАТ.№КОЛ-ВОЦЕНА, РУБ.
ГенТест-М NAT2 R2006 100 реакций (от 10 до 44 образцов)

Задать вопрос или заказать: order@evrogen.ru

© 2002-2020 Евроген.
Россия, Москва, ул. Миклухо-Маклая 16/10.