Eng | Ru

ГенТест F2, F5

Набор реагентов для выявления полиморфизмов в генах человека F2 и F5 методом ПЦР-РВ

Ген F2 кодирует фактор свертывания крови II (протромбин). Нуклеотидная замена 97G>A в гене F2 приводит к повышению экспрессии белка и увеличению концентрации протромбина в крови. Ген F5 кодирует фактор свертывания крови V. Нуклеотидная замена 1601G>A в гене F5 (мутация Лейдена) предотвращает инактивацию белка F5, активированным протеином C. Обе мутации в генах F2 и F5 повышают риск образования тромбов.

Определяемые полиморфизмы

ГЕНПОЛИМОРФИЗМНОМЕНКЛАТУРА HGVSИДЕНТИФИКАТОР dbSNPФЛАНКИРУЮЩАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ
F2 G97A NG_008953.1:g.25313G>A
NM_001311257.1:c.*97G>A
rs1799963 AATAAAAGTGACTCTCAGC[G/A]
AGCCTCAATGCTCCCAGTGC
F5 G1601A NG_011806.1:g.41721G>A
NM_000130.4:c.1601G>A
NP_000121.2:p.Arg534Gln
rs6025 GAGCAGATCCCTGGACAGGC[G/A]
AGGAATACAGGTATTTTGTC

Основные характеристики

  • Комплексный фармакогенетический скрининг мутаций в системе гемостаза
  • Анализ обоих аллелей одного аллельного варианта в одной пробирке
  • Два канала детекции - FAM и HEX
  • Автоматический анализ результатов с помощью ПО ГенТест
  • Анализ от 10 до 44 образцов
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей
  • Предел обнаружения - от 0.2 нг/мкл ДНК

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Инструкция к набору
Скачать (pdf)
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Графики амплификации образцов:

А, Б - гомозиготные;
В - гетерозиготный.

ПРОДУКТКАТ.№КОЛ-ВОЦЕНА, РУБ.
ГенТест F2, F5 R2005 100 реакций (от 10 до 44 образцов)

Задать вопрос или заказать: order@evrogen.ru

© 2002-2020 Евроген.
Россия, Москва, ул. Миклухо-Маклая 16/10.