Eng | Ru

ГенТест CYP2C19

Набор реагентов для выявления аллельных вариантов в гене человека CYP2C19 методом ПЦР-РВ

Ген CYP2C19 кодирует изофермент системы цитохрома Р-450, отвечающий за биотрансформацию лекарственных средств и метаболизм эндогенных соединений. Однонуклеотидные замены G681A в CYP2C19*2 и G636A в CYP2C19*3 снижает каталитическую активность изофермента, а замена C806T в CYP2C19*17 повышает ее. Изменение активности фермента нарушает метаболизм стероидных гормонов, жирных кислот, ретиноидов, желчных кислот, биогенных аминов, лейкотриенов и ксенобиотиков, антиагрегантов (клопидогрел), ингибиторов протонного насоса (омепразол, эзомепразол, лансопразол, пантопразол), антидепрессантов (амитриптилин, имипрамин, кломипрамин, циталопрам, доксепин, сертралин, дулоксетин, эсциталопрам, тримипрамин), противогрибковых ЛС (вориконазола) и др. веществ.

Определяемые аллельные варианты

ГЕНАЛЛЕЛЬНЫЙ ВАРИАНТНОМЕНКЛАТУРА HGVSИДЕНТИФИКАТОР dbSNPФЛАНКИРУЮЩАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ
CYP2C19 CYP2C19*2 NG_008384.2:g.24154G>A
NM_000769.2:c.681G>A
NP_000760.1:p.Pro227=
rs4244285 TTCCCACTATCATTGATTATTTCCC[G/A]
GGAACCCATAACAAATTACTTAAAA
CYP2C19*3 NG_008384.2:g.22948G>A
NM_000769.2:c.636G>A
NP_000760.1:p.Trp212Ter
rs4986893 ACATCAGGATTGTAAGCACCCCCTG[G/A]
ATCCAGGTAAGGCCAAGTTTTTTGC
CYP2C19*17 NG_008384.2:g.4195C>T
NM_000769.2:c.-806C>T
rs12248560 AAATTTGTGTCTTCTGTTCTCAAAG[С/T]
ATCTCTGATGTAAGAGATAATGCGC

Основные характеристики

  • Анализ обоих аллелей одного аллельного варианта в одной пробирке
  • Два канала детекции - FAM и HEX
  • Автоматический анализ результатов с помощью ПО ГенТест
  • Анализ от 10 до 44 образцов
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей
  • Предел обнаружения - от 0.2 нг/мкл ДНК

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Инструкция к набору
Скачать (pdf)
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Графики амплификации образцов:

А, Б - гомозиготные;
В - гетерозиготный.

ПРОДУКТКАТ.№КОЛ-ВОЦЕНА, РУБ.
ГенТест CYP2C19 R2001 100 реакций (от 10 до 44 образцов)

Задать вопрос или заказать: order@evrogen.ru

© 2002-2020 Евроген.
Россия, Москва, ул. Миклухо-Маклая 16/10.