Eng | Ru

ГенТест CES1

Набор реагентов для выявления полиморфизма в гене человека CES1 методом ПЦР-РВ

Ген CES1 кодирует карбоксилэстеразу, участвующую в биотрансформации эндогенных и экзогенных веществ, в том числе лекарственных средств и пролекарств, и в биоинактивации эфиров, амидов, карбаматов тиоэфиров и локально-стабильных соединений. Нуклеотидная замена C на A в позиции -33 приводит к синтезу фермента со сниженной активностью, замедляющей катаболизм Ацил-КоА, ацилкарнитина, триацилглицерина, эфиров холестерина, дабигатран этексилата, аспирина, капецитабина, цилазаприла, клопидогрела, кокаина, эналаприла, героина, имидаприла, иринотекана, меперидина, метилфенидата, олмесартана, орлистата, осельтамивира, квинаприла, рамиприла, тэмолаприла, фталатов, бензоатов, пиретроидов, пиретринов, фосфорорганических соединений, пестицидов, антипиренов. Таким образом, мутации в CES1 нарушают метаболические процессы, снижают устойчивость организма к ксенобиотикам и модифицируют фармакокинетику лекарственных препаратов.

Определяемые полиморфизмы

ГЕНПОЛИМОРФИЗМНОМЕНКЛАТУРА HGVSИДЕНТИФИКАТОР dbSNPФЛАНКИРУЮЩАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ
CES1 CES1 c(-33)a NG_012057.1:g.27467C>A
NM_001266.4:c.1165-33C>A
rs2244613 GAGAAGCTGCATCGCTCACC[С/A]
GGGGCTGGTGGTCACTTTTT

Основные характеристики

  • Анализ обоих аллелей в одной пробирке
  • Два канала детекции - FAM и HEX
  • Автоматический анализ результатов с помощью ПО ГенТест
  • Анализ от 10 до 44 образцов
  • Использование ДНК, выделенной из крови, буккального эпителия, тканей
  • Предел обнаружения - от 0.2 нг/мкл ДНК

Только для применения в научно-исследовательских целях.
Не для применения в медицине или ветеринарии.

Совместимость с приборами

CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Инструкция к набору
Скачать (pdf)
Программное обеспечение (ПО)
Скачать (exe)
Инструкция к ПО
Скачать (pdf)

Графики амплификации образцов:

А, Б - гомозиготные;
В - гетерозиготный.

ПРОДУКТКАТ.№КОЛ-ВОЦЕНА, РУБ.
ГенТест CES1 R2004 100 реакций (от 10 до 44 образцов)

Задать вопрос или заказать: order@evrogen.ru

© 2002-2020 Евроген.
Россия, Москва, ул. Миклухо-Маклая 16/10.