Eng | Ru

    ПОИСК ПО САЙТУ


ГенТест TPMT

Набор реагентов для выявления аллельных вариантов TPMT *2, *3B, *3C, *3D в гене человека TPMT, ассоциированных с индивидуальной чувствительностью к азатиоприну, 6-меркаптопурину и 6-тиогуанину, методом ПЦР-РВ

Применение:

Набор реагентов для выявления аллельных вариантов в гене человека TPMT (тиопуринметилтрансфераза)

Определяемые аллельные варианты 

АЛЛЕЛЬНЫЙ ВАРИАНТНОМЕНКЛАТУРА
HGVS
ИДЕНТИФИКАТОР dbSNPФЛАНКИРУЮЩАЯ ПОСЛЕДОВАТЕЛЬНОСТЬГЕНОТИП
TPMT *2
(Ala80Pro)
NG_012137.2:g.16420G>C
NM_000367.3:c.238G>C
NP_000358.1:p.Ala80Pro
rs1800462 AAGTGTAAATGTATGATTTATGCAGGTTT[G/C]CAGACCGGGGACACAGTGTA GG GC CC
*1/*1 *1/*2 *2/*2
TPMT *3B
(Ala154Thr)
NG_012137.2:g.21147G>A
NM_000367.3:c.460G>A
NP_000358.1:p.Ala154Thr
rs1800460 ACATGATTTGGGATAGAGGA[G/A]CATTAGTTGCCATCAATCCA GG GA AA
*1/*1 *1/*3B *3B/*3B
TPMT *3C
(Tyr240Cys)
NG_012137.2:g.29457A>G
NM_000367.3:c.719A>G
NP_000358.1:p.Tyr240Cys
rs1142345 CTGTCTTTTTGAAAAGTTAT[A/G]TCTACTTACAGAAAAGTAAA AA AG GG
*1/*1 *1/*3C *3C/*3C
TPMT *3D
(Glu98Stop)
NG_012137.2:g.16474G>T
NM_000367.3:c.292G>T
NP_000358.1:p.Glu98Ter
rs72552739 ATTCTGCTCTGTAAAAAATT[C/A]TTGTATCCCAAGTTCACTGA CC CA AA
*1/*1 *1/*3D *3D/*3D

Биологический материал:

Препарат ДНК человека, выделенной из крови.

Совместимость с приборами ПЦР-РВ:

CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad).

Метод:

ПЦР-РВ, качественный анализ.

Результат:

  • Мутация обнаружена
  • Мутация не обнаружена

Количественная оценка ДНК с мутацией не предполагается.

Основные характеристики:

ХАРАКТЕРИСТИКАЗНАЧЕНИЕ
Диапазон применения (качественного определения) Концентрация ДНК в исследуемом препарате 0.2-25 нг/мкл
Специфичность 100%

Состав набора:

Комплект реагентов для постановки ПЦР, включая контрольные образцы.

Количество исследуемых образцов:

От 10 до 44 образцов. Количество образцов определяется форматом постановки и степенью загрузки 96-луночного амплификатора ПЦР-РВ.

Транспортировка и хранение:

От -25 до -15°C.

Срок годности:

9 месяцев с даты изготовления при соблюдении условий хранения и транспортировки.

Инструкция (pdf)

ПРОДУКТКАТ.№ЦЕНА, РУБ.
ГенТест TPMT GC302 по запросу

Связанные продукты:

Набор реагентов ЭкстрактДНК для выделения ДНК из цельной крови с очисткой на микроцентрифужных колонках.
Набор реагентов ГенТест BRCA1, BRCA2, CHEK2, BLM для выявления мутаций в генах BRCA1, BRCA2, CHEK2, BLM.

© 2002-2017 Евроген.
Евроген, Москва, ул. Миклухо-Маклая 16/10.