Eng | Ru

    ПОИСК ПО САЙТУ


ГенТест BRCA1, BRCA2, CHEK2, BLM

Набор реагентов для выявления наследственных мутаций в генах человека: BRCA1 (185delAG; T300G; 2080delA; 4153delA; 5382insC), BRCA2 (6174delT), CHEK2 (1100delC), BLM (C1642T), ассоциированных с онкопатологией, методом ПЦР-РВ

Применение:

Набор реагентов для выявления наследственных мутаций в генах человека BRCA1, BRCA2, CHEK2, BLM.

Определяемые мутации 

ГЕНМУТАЦИЯНОМЕНКЛАТУРА
HGVS
ИДЕНТИФИКАТОР dbSNP ФЛАНКИРУЮЩАЯ ПОСЛЕДОВАТЕЛЬНОСТЬГЕНОТИП
BRCA1 185delAG NG_005905.2:g.93953_93954insAG
NM_007294.3:c.66_67insAG
NP_009225.1:p.Glu23Argfs
rs80357713 AATGCTATGCAGAAAATCTT[AG/-]AGTGTCCCATCTGGTAAGTC AG --
T300G NM_007294.3:c.181T>G
NM_007294.3:c.181T>G
NP_009225.1:p.Cys61Ser
rs28897672 GAAGAAAGGGCCTTCACAG[T/G]GTCCTTTATGTAAGAATGAT TT TG
2080delA NG_005905.2:g.124414delA
NM_007294.3:c.1961delA
NP_009225.1:p.Lys654Serfs
rs80357522 TGAAGAGATAAAGAAAAAAA[A/-]GTACAACCAAATGCCAGTCA AA A-
4153delA NG_005905.2:g.126488delA
NM_007294.3:c.4035delA
NP_009225.1:p.Glu1346Lysfs
rs80357711 GAATTGGTTTCAGATGATGA[A/-]GAAAGAGGAACGGGCTTGGA AA A-
5382insC NG_005905.2:g.160921_160922insC
NM_007294.3:c.5266_5267insC
NP_009225.1:p.Gln1756Profs
rs397507247 AAAGCGAGCAAGAGAATCCC[-/C]AGGACAGAAAGGTAAAGCTC -- -C
BRCA2 6174delT NG_012772.3:g.29822delT
NM_000059.3:c.5946delT
NP_000050.2:p.Ser1982Argfs
rs80359550 GGGATTTTTAGCACAGCAAG[T/-]GGAAAATCTGTCCAGGTATC TT T-
CHEK2 1100delC NG_008150.1:g.50966delC
NM_007194.3:c.1100delC
NP_009125.1:p.Thr367Metfs
rs555607708 TCTTGGAGTGCCCAAAATCA[C/-]TAATCTAAAATTCAGTACAA CC C-
BLM C1642T NG_007272.1:g.48644C>T
NM_001287247.1:c.1642C>T
NP_001274176.1:p.Gln548Ter
rs200389141 GCTTCAATAAATGACTTAGAAAGAGAAACC[C/T]AACCTTCCTATGATATTGAT CC CT

Биологический материал:

Препарат ДНК человека, полученный из крови.

Совместимость с приборами ПЦР-РВ:

CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad).

Метод:

ПЦР-РВ, качественный анализ.

Результат:

  • Мутация обнаружена
  • Мутация не обнаружена

Количественная оценка ДНК с мутацией не предполагается.

Основные характеристики:

ХАРАКТЕРИСТИКАЗНАЧЕНИЕ
Диапазон применения (качественного определения) Концентрация ДНК в исследуемом препарате 0.2-25 нг/мкл
Специфичность 100%

Состав набора:

Комплект реагентов для постановки ПЦР, включая контрольные образцы.

Количество исследуемых образцов:

от 12 до 45 образцов. Количество образцов определяется форматом постановки и степенью загрузки 96-луночного амплификатора ПЦР-РВ.

Транспортировка и хранение:

От -25 до -15°C.

Срок годности:

9 месяцев с даты изготовления при соблюдении условий хранения и транспортировки.

Инструкция (pdf)

ПРОДУКТКАТ.№ЦЕНА, РУБ.
ГенТест BRCA1, BRCA2, CHEK2, BLM GC102 по запросу

Связанные продукты:

Набор реагентов ЭкстрактДНК для выделения ДНК из цельной крови с очисткой на микроцентрифужных колонках.
Набор реагентов ГенТест TPMT для выявления аллельных вариантов в гене TPMT.

© 2002-2016 Евроген.
Евроген, Москва, ул. Миклухо-Маклая 16/10.